ID: 972765184_972765189

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 972765184 972765189
Species Human (GRCh38) Human (GRCh38)
Location 4:42146279-42146301 4:42146303-42146325
Sequence CCCTCCTAGTGGAAGATAAAGCT GGAGTGGAGAGAGAAAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 19, 3: 199, 4: 1484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!