ID: 972805913_972805917

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 972805913 972805917
Species Human (GRCh38) Human (GRCh38)
Location 4:42529297-42529319 4:42529335-42529357
Sequence CCTGCCATAATCTGCAGGTAACT GACAGCTCTTGGCTTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 240, 4: 279} {0: 7, 1: 178, 2: 193, 3: 137, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!