ID: 972805913_972805918

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 972805913 972805918
Species Human (GRCh38) Human (GRCh38)
Location 4:42529297-42529319 4:42529336-42529358
Sequence CCTGCCATAATCTGCAGGTAACT ACAGCTCTTGGCTTGTTACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 240, 4: 279} {0: 7, 1: 192, 2: 203, 3: 165, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!