ID: 972805913_972805920

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 972805913 972805920
Species Human (GRCh38) Human (GRCh38)
Location 4:42529297-42529319 4:42529345-42529367
Sequence CCTGCCATAATCTGCAGGTAACT GGCTTGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 240, 4: 279} {0: 4, 1: 155, 2: 168, 3: 88, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!