|
Left Crispr |
Right Crispr |
| Crispr ID |
973102922 |
973102927 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:46294720-46294742
|
4:46294767-46294789
|
| Sequence |
CCTGCCATCTTCTGCAGATAACT |
CTTGGCCCATTACTGGGCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
{0: 5, 1: 29, 2: 195, 3: 165, 4: 244} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|