ID: 973199582_973199593

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 973199582 973199593
Species Human (GRCh38) Human (GRCh38)
Location 4:47485188-47485210 4:47485215-47485237
Sequence CCGGTCAGTTGCCAGGCCCTGCC CTACGTCACGGAGGGCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 322} {0: 1, 1: 0, 2: 1, 3: 2, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!