ID: 973203650_973203655

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 973203650 973203655
Species Human (GRCh38) Human (GRCh38)
Location 4:47534441-47534463 4:47534460-47534482
Sequence CCTCTGAAGCCACAGACCCCAGA CAGACTGAAATGCCTAATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 388} {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!