ID: 973207014_973207019

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 973207014 973207019
Species Human (GRCh38) Human (GRCh38)
Location 4:47572144-47572166 4:47572183-47572205
Sequence CCTCATGAAGGTGATGGTGCCAA CAAGTGGCAGACATTGGGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207} {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!