ID: 973380655_973380656

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 973380655 973380656
Species Human (GRCh38) Human (GRCh38)
Location 4:49318031-49318053 4:49318049-49318071
Sequence CCATCTACTTGCTACTGTCACAC CACACTCTTGCCAGCAGAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!