ID: 973554900_973554907

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 973554900 973554907
Species Human (GRCh38) Human (GRCh38)
Location 4:52073058-52073080 4:52073094-52073116
Sequence CCAGGCTATGAGAGCCCCCATTC GTCACCACAGTCTTTAATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 112} {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!