ID: 973641276_973641283

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 973641276 973641283
Species Human (GRCh38) Human (GRCh38)
Location 4:52905310-52905332 4:52905359-52905381
Sequence CCAACACATACGCCAGAGGTAAC GGAGGGTTCAGCCACGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 1, 2: 2, 3: 25, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!