ID: 973699633_973699644

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 973699633 973699644
Species Human (GRCh38) Human (GRCh38)
Location 4:53523851-53523873 4:53523901-53523923
Sequence CCACCATCCTCCTGCTTCCCCTG AGTCATGGAATAAGTTGATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 127, 4: 1096} {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!