ID: 973734424_973734431

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 973734424 973734431
Species Human (GRCh38) Human (GRCh38)
Location 4:53856541-53856563 4:53856572-53856594
Sequence CCATCAGTTAGAAGGTGTCAAAG GAATGACTTGTAGGGAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134} {0: 1, 1: 0, 2: 3, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!