ID: 973752177_973752181

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 973752177 973752181
Species Human (GRCh38) Human (GRCh38)
Location 4:54032289-54032311 4:54032304-54032326
Sequence CCCTCTACGGTCTCCCTCTGATG CTCTGATGCCGAGCCGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 87, 2: 25, 3: 15, 4: 113} {0: 419, 1: 561, 2: 478, 3: 168, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!