ID: 974062966_974062974

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 974062966 974062974
Species Human (GRCh38) Human (GRCh38)
Location 4:57052276-57052298 4:57052316-57052338
Sequence CCTCAAAGGTTCCAGGAGGCTGC CAGGGGTGTCAGTCTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!