ID: 974391442_974391446

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 974391442 974391446
Species Human (GRCh38) Human (GRCh38)
Location 4:61275134-61275156 4:61275148-61275170
Sequence CCCCAAACTACATACTGTTCATA CTGTTCATACAACTGGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 103, 4: 334} {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!