ID: 974779078_974779083

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 974779078 974779083
Species Human (GRCh38) Human (GRCh38)
Location 4:66528331-66528353 4:66528366-66528388
Sequence CCCTACACTAGAGATTTGTGGAA GAGAGGTGATTTAGGGCATCTGG
Strand - +
Off-target summary No data {0: 2, 1: 115, 2: 1459, 3: 1973, 4: 1634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!