ID: 974908237_974908245

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 974908237 974908245
Species Human (GRCh38) Human (GRCh38)
Location 4:68083071-68083093 4:68083113-68083135
Sequence CCACATAAGCTGCATACCCATGA GACCCCTCACCCTTGACAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!