ID: 974951498_974951500

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 974951498 974951500
Species Human (GRCh38) Human (GRCh38)
Location 4:68588577-68588599 4:68588592-68588614
Sequence CCAGCAATCAATGAATTTCAGCC TTTCAGCCACCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117} {0: 2, 1: 556, 2: 14977, 3: 127532, 4: 226029}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!