ID: 974951844_974951847

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 974951844 974951847
Species Human (GRCh38) Human (GRCh38)
Location 4:68592331-68592353 4:68592374-68592396
Sequence CCTGGTAGGATTTTCATATTTTG GGAAGAAAAACAATGAATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 316} {0: 1, 1: 1, 2: 9, 3: 97, 4: 819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!