ID: 974981988_974981996

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 974981988 974981996
Species Human (GRCh38) Human (GRCh38)
Location 4:68968142-68968164 4:68968190-68968212
Sequence CCCACCTAAATCTTATCTTGAAT CATGGGAGGAAGACAGTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 16, 3: 309, 4: 1691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!