ID: 975116132_975116136

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 975116132 975116136
Species Human (GRCh38) Human (GRCh38)
Location 4:70683220-70683242 4:70683245-70683267
Sequence CCCACTCCAGCCAAGAAAGATTA ATTTAATCTAGTGTCTATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 199} {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!