ID: 975192049_975192055

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 975192049 975192055
Species Human (GRCh38) Human (GRCh38)
Location 4:71475898-71475920 4:71475946-71475968
Sequence CCTTGAAGTGTAAGTAATAGAAT CCTTCTAGGCATACATTGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!