ID: 975193760_975193764

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 975193760 975193764
Species Human (GRCh38) Human (GRCh38)
Location 4:71498197-71498219 4:71498223-71498245
Sequence CCCGTAATGATGAATGCCGTAGT GAGAAACAGATAATTAAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 4, 3: 44, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!