ID: 975418812_975418825

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 975418812 975418825
Species Human (GRCh38) Human (GRCh38)
Location 4:74138632-74138654 4:74138679-74138701
Sequence CCCTGCTGGATCCGGAGGAGTGG CAGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 71, 3: 136, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!