ID: 975473901_975473904

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975473901 975473904
Species Human (GRCh38) Human (GRCh38)
Location 4:74799903-74799925 4:74799926-74799948
Sequence CCACCTAATAATGGTCCACATAA CTAGTTAGTTTTGAGATCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!