ID: 975490001_975490006

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 975490001 975490006
Species Human (GRCh38) Human (GRCh38)
Location 4:74977438-74977460 4:74977473-74977495
Sequence CCTCTGATAACTATGGGATGGGA GCTGAACCTACAACTAATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!