ID: 975493756_975493758

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 975493756 975493758
Species Human (GRCh38) Human (GRCh38)
Location 4:75015725-75015747 4:75015739-75015761
Sequence CCCAGAAGTTTGAAGTGCCTCAC GTGCCTCACCCAAGATCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 131} {0: 1, 1: 1, 2: 8, 3: 62, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!