ID: 975498455_975498461

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 975498455 975498461
Species Human (GRCh38) Human (GRCh38)
Location 4:75058787-75058809 4:75058823-75058845
Sequence CCACTAGGCTGAGTGGGTGGAAC CTGAGCAATGCTCAGGCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 27, 3: 63, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!