ID: 975585393_975585407

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 975585393 975585407
Species Human (GRCh38) Human (GRCh38)
Location 4:75943098-75943120 4:75943144-75943166
Sequence CCTTCCTGCCTCAGCTAAGCCAC ACTGTGAAGCAGGCCGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 365} {0: 1, 1: 1, 2: 9, 3: 93, 4: 810}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!