ID: 975613152_975613162

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 975613152 975613162
Species Human (GRCh38) Human (GRCh38)
Location 4:76221135-76221157 4:76221154-76221176
Sequence CCACAGGAAGAAAAACCCATTGT TTGTGGCAGGGGAAGGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 266} {0: 1, 1: 0, 2: 3, 3: 73, 4: 746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!