ID: 975614996_975615005

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 975614996 975615005
Species Human (GRCh38) Human (GRCh38)
Location 4:76237269-76237291 4:76237313-76237335
Sequence CCCACTTCCCATCATGCCTCAGG GCTGAGAAAGTCCATTCAGATGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 7, 3: 100, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!