ID: 975683491_975683497

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 975683491 975683497
Species Human (GRCh38) Human (GRCh38)
Location 4:76897910-76897932 4:76897930-76897952
Sequence CCAGAGGAAACCCTGGCCGGGCG GCGAGTGTCACCTGCGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87} {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!