ID: 975710589_975710598

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 975710589 975710598
Species Human (GRCh38) Human (GRCh38)
Location 4:77157285-77157307 4:77157304-77157326
Sequence CCGGCGTTGCGCCGCGGCGGAGG GAGGGTGGGCGCGCGGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 55} {0: 1, 1: 2, 2: 9, 3: 101, 4: 1022}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!