ID: 975732777_975732792

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 975732777 975732792
Species Human (GRCh38) Human (GRCh38)
Location 4:77354003-77354025 4:77354055-77354077
Sequence CCTTGGTGAGGTTGGAGCCTCAG AGAAGGAACTGGCAGGGAGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 27, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!