ID: 975732782_975732791

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 975732782 975732791
Species Human (GRCh38) Human (GRCh38)
Location 4:77354026-77354048 4:77354054-77354076
Sequence CCAGGCAGCCTCCAGAGGGTGTC GAGAAGGAACTGGCAGGGAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 287} {0: 2, 1: 0, 2: 8, 3: 83, 4: 1184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!