ID: 975735028_975735031

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 975735028 975735031
Species Human (GRCh38) Human (GRCh38)
Location 4:77372686-77372708 4:77372730-77372752
Sequence CCACTTGTGAGTTGTAGCTCTGA GATAGTAATTCCCCTCCTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!