ID: 975735081_975735093

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 975735081 975735093
Species Human (GRCh38) Human (GRCh38)
Location 4:77373027-77373049 4:77373068-77373090
Sequence CCCCAGCCAGAACTGGGGCAGCC CTCAATCCCCAGAGTAAGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 44, 4: 336} {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!