ID: 975804619_975804628

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 975804619 975804628
Species Human (GRCh38) Human (GRCh38)
Location 4:78099078-78099100 4:78099121-78099143
Sequence CCTCATTGCTTTAGTTTATAAGG CCTAGGTCTCAGCTTTAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 505} {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!