ID: 975874833_975874839

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 975874833 975874839
Species Human (GRCh38) Human (GRCh38)
Location 4:78824356-78824378 4:78824405-78824427
Sequence CCATGTGGCTGGGGAGGCCTCAC CAGAGTTACAACTTACATGGTGG
Strand - +
Off-target summary {0: 590, 1: 1821, 2: 4838, 3: 6940, 4: 5923} {0: 1, 1: 1, 2: 14, 3: 322, 4: 981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!