ID: 975977105_975977109

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975977105 975977109
Species Human (GRCh38) Human (GRCh38)
Location 4:80112088-80112110 4:80112111-80112133
Sequence CCAATGTGCGTTCATGAAATGTA ACAAATATACTACTCTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84} {0: 3, 1: 36, 2: 153, 3: 424, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!