ID: 976064156_976064164

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 976064156 976064164
Species Human (GRCh38) Human (GRCh38)
Location 4:81164623-81164645 4:81164663-81164685
Sequence CCATTAGAGTGTTAGGTGTGGAT AGTTTCCGATTCAGTAAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 107} {0: 1, 1: 3, 2: 40, 3: 324, 4: 1115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!