ID: 976092416_976092425

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 976092416 976092425
Species Human (GRCh38) Human (GRCh38)
Location 4:81471961-81471983 4:81471975-81471997
Sequence CCCGCTGCCAGCCCCGCCCCGCC CGCCCCGCCCCGGCAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 188, 4: 1472} {0: 1, 1: 0, 2: 2, 3: 46, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!