ID: 976141547_976141551

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 976141547 976141551
Species Human (GRCh38) Human (GRCh38)
Location 4:81998469-81998491 4:81998505-81998527
Sequence CCAATGGGCAGAATGAGTGAGTC TGACTAAAAGAAACTTTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 17, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!