ID: 976208594_976208598

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 976208594 976208598
Species Human (GRCh38) Human (GRCh38)
Location 4:82645040-82645062 4:82645055-82645077
Sequence CCGGTGGCTCACACCTGTAATTC TGTAATTCCGGCACTTTGGAAGG
Strand - +
Off-target summary {0: 38, 1: 888, 2: 2247, 3: 2738, 4: 2176} {0: 4, 1: 705, 2: 25566, 3: 326488, 4: 261857}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!