|
Left Crispr |
Right Crispr |
Crispr ID |
976208594 |
976208601 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:82645040-82645062
|
4:82645064-82645086
|
Sequence |
CCGGTGGCTCACACCTGTAATTC |
GGCACTTTGGAAGGCCAAGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 38, 1: 888, 2: 2247, 3: 2738, 4: 2176} |
{0: 40, 1: 2965, 2: 63773, 3: 153157, 4: 160108} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|