ID: 976208594_976208601

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 976208594 976208601
Species Human (GRCh38) Human (GRCh38)
Location 4:82645040-82645062 4:82645064-82645086
Sequence CCGGTGGCTCACACCTGTAATTC GGCACTTTGGAAGGCCAAGGTGG
Strand - +
Off-target summary {0: 38, 1: 888, 2: 2247, 3: 2738, 4: 2176} {0: 40, 1: 2965, 2: 63773, 3: 153157, 4: 160108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!