ID: 976455819_976455831

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 976455819 976455831
Species Human (GRCh38) Human (GRCh38)
Location 4:85246139-85246161 4:85246185-85246207
Sequence CCCTCGCTCGGCCTGGCCATGGC TCCCTAGGGCGTGGGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155} {0: 1, 1: 0, 2: 2, 3: 29, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!