ID: 976482161_976482168

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 976482161 976482168
Species Human (GRCh38) Human (GRCh38)
Location 4:85557364-85557386 4:85557404-85557426
Sequence CCATGTGTGCTTGAGCAGGGCTC AGTTCTCTGTGTTGGTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 174} {0: 1, 1: 0, 2: 10, 3: 41, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!