ID: 976726911_976726919

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 976726911 976726919
Species Human (GRCh38) Human (GRCh38)
Location 4:88223741-88223763 4:88223794-88223816
Sequence CCTGAAGTAGGAACTGGAGCTCT CCTCATCTGGAGAGGGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 12, 4: 153} {0: 1, 1: 8, 2: 9, 3: 36, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!