ID: 976775600_976775602

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 976775600 976775602
Species Human (GRCh38) Human (GRCh38)
Location 4:88702855-88702877 4:88702869-88702891
Sequence CCACTTGTGAGAGACTGAATATT CTGAATATTCCTATGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 336} {0: 1, 1: 0, 2: 3, 3: 43, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!